Strains and Plasmids
The wild-type strain used in this study was Saccharomyces cerevisiae DBY7286 (MATa ura3-52 GAL2). YHY804 (MATa ura3-52 GAL2 crz1::KANMX4) was constructed by one-step gene replacement method mentioned integrating kanMX in the CRZ1 locus in the strain DBY7286 as described previously. The E. coli GST-Crz1p expression plasmid, pRSP121 was made by inserting a HindIII/SalI fragment containing the CRZ1 ORF into pGEX4T-3 (Amersham Pharamcia Biotech, Piscataway, NJ) digested with HindIII and XhoI.
Medium
YPD (1% yeast extract, 2% Bacto-peptone, and 2% dextrose) was used. Where noted, YPD containing either 0.4M CaCl2 or 1.6 M NaCl was mixed with an equal volume of YPD to achieve final concentrations of 0.2M CaCl2 and 0.8 M NaCl. YPD containing 0.4M CaCl2 was buffered to pH 5.0 with 7.5 mM succinate to prevent precipitation of CaPO4. Where noted, a 20 mg/ml stock solution of FK506 (Fujisawa, Inc., Deerfield, IL), in ET (90% ethanol and 10% Tween) or ET was also added to YPD at a 1:20,000 fold dilution (FK506 final concentration: 1 mg/ml).
Culture Conditions
Experiments 1 and 2: Ca2+, Ca2++FK506 Time Course
Cells were grown at 30oC in YPD medium (buffered to pH 5.0 with 7.5 mM succinate) containing ET solution to a density of 0.6 X 107 cells/ml (A600=0.6). The culture was divided into two. One was supplemented with ET at 30oC for 15 min. The other was supplemented with FK506 (1.0 mg/?l final concentration) in ET at 30oC for 15 min. Cells were collected for the t=0 min sample. Next, an equal volume of YPD medium (pH 5.0) containing ET and 0.4 M CaCl2 was added to the ET-treated culture (final concentration 0.2 M CaCl2). Also, an equal volume of YPD medium (pH 5.0) containing FK506 (1.0 mg/?l) and 0.4 M CaCl2 was added to the FK506-treated culture (final concentration 0.2 M CaCl2). Cells were collected by centrifugation at 5, 15, 30 and 60 min, frozen at ?80oC and processed for RNA extraction (see below).
Experiment 3: Ca2++FK/ Ca2+
Cells were cultured with or without FK506 treatment and exposed to CaCl2 as described for Experiments 1 and 2. Samples were collected from the drug-treated and control cultures at 15 and 30 min after Ca2+ addition.
Experiment 4: crz1/CRZ1: Ca2+
Wild-type strain DBY7286 and the crz1D strain YHY804 were cultured and exposed to CaCl2 as described for Experiments 1 and 2. Samples were collected at 15 and 30 min after Ca2+ addition.
Experiments 5 and 6: Na+, Na++FK506 Time Course
Cells were grown in YPD medium (pH 5.0) at 30oC to a density of 0.6 X 107 cells/ml (A600=0.6). The culture was divided into two. One was supplemented with ET at 30 oC for 15 min. The other was supplemented with FK506 (1.0 mg/?l) in ET at 30oC for 15 min. Cells were collected for the t=0 min sample. Next, an equal volume of YPD medium (pH 5.0) containing ET solution and 1.6 M NaCl was added to the ET-treated culture (final concentration 0.8 M NaCl). Also, an equal volume of YPD medium (pH 5.0) containing FK506 (1.0 mg/?l) and 1.6 M NaCl was added to the FK506-treated culture (final concentration 0.8 M NaCl). Samples were collected 15, 30, 45 and 60 minutes after Na+ addition.
Experiment 7: Na++FK/Na+
Cells were cultured with or without FK506 treatment and exposed to 0.8 M NaCl as described for Experiments 5 and 6. Samples were collected from the drug-treated and control cultures at 30 and 45 min after Na+ addition.
Experiment 8: crz1/CRZ1:Na+
Wild-type strain DBY7286 and the crz1 mutant strain YHY804 were cultured and exposed to NaCl as described for Experiments 5 and 6. Samples were collected at 30 and 45 min after Na+ addition.
RNA Isolation
Total RNA was extracted by the hot acid phenol method as described (30). mRNA was purified from total RNA using the Micro-FastTrack 2.0 kit (Invtrogen, Carlsbad, CA). Quantitation of RNA was carried out by UV spectroscopy. cDNA was synthesized from mRNA by reverse transcription and incorporated Cy3-dUTP and Cy5-dUTP (Amersham Pharmacia Biotech) into the cDNA. The fluorescently labeled product was recovered and used as a hybridization probe as previously described.
Microarray Analysis
The time-course experiments were performed by directly comparing the abundance of mRNA relative to the t=0 sample as shown in Table 1. mRNA from the t=0 sample was labeled with Cy3 (represented as green color), and mRNA from treated samples, harvested at the indicated times, was labeled with Cy5 (represented as red color). mRNA levels of the crz1 mutant strain were compared to those of the isogenic wild-type strain as shown in Table 1. mRNA from the crz1 mutant strain was labeled with Cy5, and mRNA from the isogenic wild-type strain was labeled with Cy3. Yeast ORF DNA microarrays were prepared, processed and analyzed as previously described. The microarrays were scanned with a Gene Pix 4000 scanner (Axon instruments, Foster City, CA) and the Gene Pix 4000 software package was used to locate spots in the microarray. Each microarray experiment was performed in duplicate. Data analysis was performed using the software GeneCluster and TreeView. For each data set, results from two independent microarrays were averaged, and a gene was considered to have consistently altered expression if its average fold change in duplicate arrays was more than two.
Crz1p DNA binding analysis:
GST-Crz1p expressed from pRSP121 in E.coli strain BLR was purified from French press extracts using glutathione agarose beads (Amersham Pharmacia Biotech) according to manufacturer?fs instructions. The CDRE probe was generated by annealing synthetic oligonucleotides (CDREB: 5?f TCGACAAGCGCACAGCCACCGACTGGTG 3?f and CDRET: 5?f GATCCACCAGTCGGTGGCTGTGCGCTTG 3?f) and labeled with 32P-g-ATP using T4 polynucleotide kinase as recommended by the manufacturer (New England Biolabs, Beverly, MA). Full length products were purified from a denaturing polyacrylamide gel (5M urea, 15% acrylamide, 1XTBE), and each labeled oligonucleotide was then annealed to its unlabeled compliment by heating to 100oC and slowly cooling the mixture (1.5 pmoles CDRET, 1.5 pmoles CDREB, 50 mM NaCl, 2 mM MgCl2). Methylation of 0.5 pmoles CDRE was carried out in DMS reaction buffer (50 mM sodium cacodylate, 1 mM EDTA pH8, 0.5% dimethy sulfate (DMS) for 5 minutes. EMSA was then carried out as described below using 0.5 pmoles methylated CDRE and 30 pmoles GST-Crz1p. The bands corresponding to the ?gbound?h and ?gfree?h CDRE were identified by autoradiography and isolated from the gel. Cleavage at methylated bases was carried out by resuspending the samples in 10mM sodium phosphate pH7 and incubating for 15 minutes at 90oC, followed by the addition of NaOH to 100mM and incubating an additional 30 minutes. The fragments were then separated on a denaturing polyacrylamide gel (20% acrylamide, 1XTBE, 5M urea) and visualized by autoradiography.
Electrophoretic mobility shift assay (EMSA):
The EMSA was carried out in 20 ml gel shift buffer (1mM MgCl2, 10mM Hepes 7.9,10% glycerol, 50mM KCl, 0.1mM EDTA, 1mM DTT, 1mM PMSF, 1 mg/ml aprotinin, 2 mg/ml leupeptin) containing 0.5pmoles methylated CDRE, 30 pmoles GST-Crz1p and 3 mg poly dIdC (Pharmacia). After 10 minute incubation at room temperature the reaction was run on a native 4% polyacrylamide TBE gel, dried down and visualized by autoradiography.
Binding Site Selection-Amplification Analysis
GST-Crz1p purified from E. coli (see above) was incubated with a partially degenerate pool of DNA sequences. Sequences that bound GST-Crz1p were then isolated using the electrophoretic mobility shift assay (EMSA), amplified by PCR, and enriched by carrying out three more cycles of EMSA followed by PCR. Finally, the selected sequences were subcloned and sequenced. Experimental details of each step are as follows:
Generation of random sequences: A 60-nucleotide oligonucleotide, 5?f CAGTCAGTTCAAAGCTTCAT(N)20AAGTCTAGAACTGACTAGTC 3?f (where N is any of the four bases and the HindIII and XbaI sites in the constant regions that were included for subcloning are underlined) was made double stranded by PCR using primers complimentary to the constant regions (primer 1: 5?f GACTAGTCAGTTCTAGACTT 3?f and primer 2: 5?f CAGTCAGTTCAAAGCTTCAT 3?f) and 20 cycles of the following conditions: 45 seconds at 94oC, 45 seconds at 50oC, 45 seconds at 72oC. The PCR was carried out using taq DNA polymerase under conditions recommended by the manufacturer (New England Biolabs) except that 1 pmole of 5?f-32P-labeled primer 2 was included in the reaction. Primer 2 was labeled using T4 polynucleotide kinase (New England Biolabs) as recommended by the manufacturer and 32P-g-ATP (Amersham Pharmacia Biotech). The double stranded product (dsR60) was gel isolated from a native 8% polyacrylamide/TBE gel.
Electrophoretic Mobility Shift Assay: The first round of EMSA was performed in 50 ml gel shift buffer (see above) to which 10 pmoles dsR60, 3 ?g (29 pmoles) pure GST-CRZ1p, and 3 mg dIdC were added, After 10?f incubation at room temperature the bound molecules were separated from the free on a native 4% acrylamide/TBE gel and the bound fraction was localized by comparison with a parallel lane in which the CDRE sequence localized within a 60 bp DNA fragment served as probe. The bound fraction was electroeluted from the gel slice, ethanol precipitated, and amplified by PCR as described above. Rounds 2-4 were carried out like round one except that 6 pmoles of dsR60 were used in the EMSA.
Subcloning and Sequencing: Following PCR amplification of round 4 the selected molecules were digested with Hind III and XbaI and subcloned into pBluescript SK+ (Stratagene, La Jolla, CA) digested with the same enzymes. The resulting clones were sequenced using BigDye (Perkin Elmer/ABI, Wellesley, MA) and analyzed at the Stanford PAN Facility (Stanford University, Stanford, CA).
Conserved Motif Identification Analysis
For each gene that was expressed 4 fold more in wild-type than crz1D cells in at least one experiment (40 total), 800 bp of DNA sequence upstream of the ATG was analyzed using MEME (http://www.sdsc.edu/MEME/meme/website/meme.html) and Regulatory Sequence Analysis tools (http://embnet.cifn.unam.mx/~jvanheld/rsa-tools/) to identify common motifs. Crz1p-binding sequences identified through site selection were also analyzed using MEME.
[ Home : See the paper : Explore : Figures : Table : Download : Stanford Microarray Database : Material and Methods : Contact : Cyert Home]
|